Solution reagent kit Quick-ITS Plus

NGS

The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples. 100% automation ready with only a single PCR step and without the need for normalization. Real-time PCR enables absolute microbial copy number quantification. DESCRIPTION The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes. Amplicon Size - The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. Barcode Sequences - 10 bp barcodes, Available for download here (USA Only), or under the Documents section as "Barcode Sequences". Index Primers - Dual index (barcodes) to uniquely label samples. ITS Primer Sequences - (adapters not included) ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). Required Equipment - Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates.