Solution reagent kit Quick-ITS Plus
NGS

Solution reagent kit - Quick-ITS Plus - Zymo Research - NGS
Solution reagent kit - Quick-ITS Plus - Zymo Research - NGS
Add to favorites
Compare this product

fo_shop_gate_exact_title

Characteristics

Type
solution
Applications
NGS

Description

The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples. 100% automation ready with only a single PCR step and without the need for normalization. Real-time PCR enables absolute microbial copy number quantification. DESCRIPTION The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes. Amplicon Size - The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. Barcode Sequences - 10 bp barcodes, Available for download here (USA Only), or under the Documents section as "Barcode Sequences". Index Primers - Dual index (barcodes) to uniquely label samples. ITS Primer Sequences - (adapters not included) ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). Required Equipment - Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates.

Catalogs

No catalogs are available for this product.

See all of Zymo Research‘s catalogs
*Prices are pre-tax. They exclude delivery charges and customs duties and do not include additional charges for installation or activation options. Prices are indicative only and may vary by country, with changes to the cost of raw materials and exchange rates.